klhl17

Ensembl ID:
ENSDARG00000037324
ZFIN ID:
ZDB-GENE-030131-8131
Human Orthologue:
KLHL17
Human Description:
kelch-like 17 (Drosophila) [Source:HGNC Symbol;Acc:24023]
Mouse Orthologue:
Klhl17
Mouse Description:
kelch-like 17 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2678948]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29918 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37694 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29918
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089050 Essential Splice Site 431 591 9 11
ENSDART00000132296   None 107 None 3
ENSDART00000137353 Essential Splice Site 431 591 10 12
Genomic Location (Zv9):
Chromosome 23 (position 23504203)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23283510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTGCACTATACTGCAAACACATGCCTATTTCACATATTTCTCTTTC[A/T]GATGGCAGTTTGTATGCAGTCGGTGGGTACGACAGCTCTTCACACTTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089050 Essential Splice Site 516 591 10 11
ENSDART00000132296   None 107 None 3
ENSDART00000137353 Essential Splice Site 516 591 11 12
Genomic Location (Zv9):
Chromosome 23 (position 23504559)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 23283866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCCAAAACCAACACGTGGGAAGGAGTGGCTCCTATGAACATCCGCAG[G/A]TTCGATTGTGACTTTATCAATTCATTAATTTTCCAGCCGCAACCCATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link