fam131c

Ensembl ID:
ENSDARG00000037320
ZFIN ID:
ZDB-GENE-050706-119
Description:
hypothetical protein LOC619198 [Source:RefSeq peptide;Acc:NP_001028762]
Human Orthologue:
FAM131C
Human Description:
family with sequence similarity 131, member C [Source:HGNC Symbol;Acc:26717]
Mouse Orthologue:
Fam131c
Mouse Description:
family with sequence similarity 131, member C Gene [Source:MGI Symbol;Acc:MGI:2685539]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37701 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054293 Nonsense 139 257 4 6
Genomic Location (Zv9):
Chromosome 23 (position 24595673)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24382008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGGACGAGCAGCTCTACTCCCACCTCACCGATGAAATTAAAGAGGCC[C/T]GATTTGCTGCGGGTGAGACTGTTTATCTACCTAAAGGGATGACGTTGTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link