ddost

Ensembl ID:
ENSDARG00000037318
ZFIN ID:
ZDB-GENE-040426-2147
Description:
Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 48 kDa subunit [Source:UniProtKB/Swis
Human Orthologue:
DDOST
Human Description:
dolichyl-diphosphooligosaccharide--protein glycosyltransferase [Source:HGNC Symbol;Acc:2728]
Mouse Orthologue:
Ddost
Mouse Description:
dolichyl-di-phosphooligosaccharide-protein glycotransferase Gene [Source:MGI Symbol;Acc:MGI:1194508]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9278 Nonsense Mutation detected in F1 DNA During 2017
sa37698 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054290 Nonsense 243 466 7 11
ENSDART00000124539 Nonsense 218 441 7 11
Genomic Location (Zv9):
Chromosome 23 (position 24518204)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24304770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCWTACGTTTATTTCAACTCGTGCTAATTGTCTGTWTGCTCTCCAGTA[T/A]CCTCATGCAGTTGGAAAGAACACCCTTCTAATCGCTGGTYTRCAGGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054290 Nonsense 343 466 9 11
ENSDART00000124539 Nonsense 318 441 9 11
Genomic Location (Zv9):
Chromosome 23 (position 24515704)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 24302270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAGCATTATGACTCACTACAACTGACTGGATTGTCCCTACAGGAATA[T/G]GGCATAGTGATTGAGATGTTGTCTGGTGGAAAGTGGGTGCCCTTTGATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link