pet112l

Ensembl ID:
ENSDARG00000037309
ZFIN ID:
ZDB-GENE-040724-131
Description:
glutamyl-tRNA(Gln) amidotransferase subunit B, mitochondrial-like [Source:RefSeq peptide;Acc:NP_001
Human Orthologue:
PET112L
Human Description:
PET112-like (yeast) [Source:HGNC Symbol;Acc:8849]
Mouse Orthologue:
Pet112l
Mouse Description:
PET112-like (yeast) Gene [Source:MGI Symbol;Acc:MGI:2442496]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25576 Nonsense Mutation detected in F1 DNA During 2017
sa39613 Nonsense Mutation detected in F1 DNA During 2017
sa19500 Essential Splice Site Available for shipment Available now
sa6125 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054271 Nonsense 21 178 1 7
ENSDART00000102522 Nonsense 21 553 1 13

The following transcripts of ENSDARG00000037309 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 23414006)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23866368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACTTCAGGATACAGCGGTGTACTCTTCAGGCTGAGGAAATATGCTAAT[A/T]AATCACAAAGTTTATGCCATATTGGTAATTCTAACTTCATAATAAGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39613
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054271   None 178 None 7
ENSDART00000102522 Nonsense 345 553 9 13

The following transcripts of ENSDARG00000037309 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 23383124)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23835486
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTACTCTCAGGTTCATGCCAGAGCCCAACTTGCCACCACTGTTTGTGTA[T/G]GAGAGTGAAGCCTCGGTGCCCGCTGGTGCTGACTCCACCCAGCTCGTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19500
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054271   None 178 None 7
ENSDART00000102522 Essential Splice Site 396 553 9 13

The following transcripts of ENSDARG00000037309 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 23382969)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23835331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTGTGGAGACTTACGGCATCCTGAGAGAGCACAGCTTCACACTTGTGG[T/C]GAGACTGTTCACATGCTTGTTTTATAAAACAAATTTACTATCAGGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054271 Essential Splice Site 174 178 None 7
ENSDART00000102522   445 553 11 13

The following transcripts of ENSDARG00000037309 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 23380255)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 23832617
KASP Assay ID:
554-3689.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTGATTGTAATCTATTCTTTCCAACCCGTTCTCAGTCCCGTCKCTCC[A/C]TGTGCTCTCGCTGAGATGATCAATCTTGTARGATCGGGTCACATCTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link