gnpda1

Ensembl ID:
ENSDARG00000037307
ZFIN ID:
ZDB-GENE-050417-417
Description:
glucosamine-6-phosphate isomerase 1 [Source:RefSeq peptide;Acc:NP_001017867]
Human Orthologue:
GNPDA1
Human Description:
glucosamine-6-phosphate deaminase 1 [Source:HGNC Symbol;Acc:4417]
Mouse Orthologue:
Gnpda1
Mouse Description:
glucosamine-6-phosphate deaminase 1 Gene [Source:MGI Symbol;Acc:MGI:1347054]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22471 Nonsense Available for shipment Available now
sa38996 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054266 Nonsense 65 269 3 7
ENSDART00000136909 Nonsense 65 275 2 5

The following transcripts of ENSDARG00000037307 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 24614185)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23412709
KASP Assay ID:
2260-7520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAGAAACTGATCGAGTACCACAAGAAGGGAGAAATATCTTTTCAGTA[T/A]GTGAAAACGTTTAATATGGATGAGTATGTAGGTATGTGAGCAGACATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054266 Essential Splice Site 137 269 None 7
ENSDART00000136909 Essential Splice Site 137 275 None 5

The following transcripts of ENSDARG00000037307 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 24614573)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23413097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTCCTTTGCATGGTATGTGAATGAACTTTGTCTTGTGCTCACATTGC[A/C]GGGATTGGACCTGATGGTCACATTGCATTCAATGAGCCTGGTTCCAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link