CHRM1 (1 of 2)

Ensembl ID:
ENSDARG00000037292
Description:
cholinergic receptor, muscarinic 1 [Source:HGNC Symbol;Acc:1950]
Human Orthologue:
CHRM1
Human Description:
cholinergic receptor, muscarinic 1 [Source:HGNC Symbol;Acc:1950]
Mouse Orthologue:
Chrm1
Mouse Description:
cholinergic receptor, muscarinic 1, CNS Gene [Source:MGI Symbol;Acc:MGI:88396]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22472 Nonsense Mutation detected in F1 DNA During 2014
sa6343 Nonsense Mutation detected in F1 DNA During 2014
sa4557 Nonsense F2 line generated During 2014
sa7744 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106074 Nonsense 163 479 1 4
Genomic Location:
Chromosome 14 (position 25258714)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACCATCTCGTTTGTGATTTGGGCTCCAGCAATTTTGTTTTGGCAGTA[T/A]ATAGTTGGGGAACGGACTGTTCAGGAAAATGAGTGTTCAATACAGTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6343
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106074 Nonsense 195 479 1 4
Genomic Location:
Chromosome 14 (position 25258810)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTGTCAGAGCCTGTGATCACCTTTGGAACAGCCATCGCTGCATTTTA[C/A]CTGCCAGTAAGTGTGATGGTGGCATTGTACTGGCGTGTGTATCGTGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4557
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106074 Nonsense 229 479 1 4
Genomic Location:
Chromosome 14 (position 25258910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGAAGCGCTCTCAGAAGCTGGCTGGACTGATGGCGTCACAGGGAGGA[C/T]GAACTGGAAATGCATCTCAGGTGGGTTTTACAGTAAAGACCTTGTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106074 Nonsense 323 479 4 4
Genomic Location:
Chromosome 14 (position 25261949)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGGAAAGGGAAGACATTTCCAACTCATACGCTACAAACAACCATYCA[C/T]AAGTGGACTTTATTTCTTCAAGAACAGACCATAATAACAAATACATCCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kzb1rlbh