dpf2l

Ensembl ID:
ENSDARG00000037291
ZFIN ID:
ZDB-GENE-030131-5132
Description:
D4, zinc and double PHD fingers family 2, like [Source:RefSeq peptide;Acc:NP_997861]
Human Orthologue:
DPF2
Human Description:
D4, zinc and double PHD fingers family 2 [Source:HGNC Symbol;Acc:9964]
Mouse Orthologue:
Dpf2
Mouse Description:
D4, zinc and double PHD fingers family 2 Gene [Source:MGI Symbol;Acc:MGI:109529]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28306 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054243 Essential Splice Site 65 405 2 11
Genomic Location (Zv9):
Chromosome 14 (position 25276244)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 23979335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAAAGCAACTGCTATATTTGGATGGAGAAGAGGCACAGGAGTGCAGG[T/C]ACAATAAAAACAGCATCAGTCCGATACACAGATTCTATTTTCAGTCTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link