mipa

Ensembl ID:
ENSDARG00000037285
ZFIN ID:
ZDB-GENE-040801-41
Description:
major intrinsic protein of lens fiber a [Source:RefSeq peptide;Acc:NP_001003534]
Human Orthologue:
MIP
Human Description:
major intrinsic protein of lens fiber [Source:HGNC Symbol;Acc:7103]
Mouse Orthologue:
Mip
Mouse Description:
major intrinsic protein of eye lens fiber Gene [Source:MGI Symbol;Acc:MGI:96990]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32445 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054238 Nonsense 156 263 2 4
Genomic Location (Zv9):
Chromosome 23 (position 27309819)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27142641
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCTTGTGGTTTGTGTGTTCGCTGTGACCGATGAGAGGAGAAACGGG[C/T]GACTGGGGTCTGCTGCCCTGTCCATTGGCTTTTCTGTGCTAGTGGGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link