ptges3a

Ensembl ID:
ENSDARG00000037284
ZFIN ID:
ZDB-GENE-040426-2200
Description:
prostaglandin E synthase 3 [Source:RefSeq peptide;Acc:NP_998335]
Human Orthologue:
PTGES3
Human Description:
prostaglandin E synthase 3 (cytosolic) [Source:HGNC Symbol;Acc:16049]
Mouse Orthologue:
Ptges3
Mouse Description:
prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI Symbol;Acc:MGI:1929282]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa112 Nonsense Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa112
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054237 Nonsense 122 159 5 8
Genomic Location (Zv9):
Chromosome 23 (position 27297695)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27130517
KASP Assay ID:
554-0055.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGAAAGACTGGGAGGATGACTCGGATGAAGAATTGTCCAGTTTTGAC[C/T]GATTTTCAGAGGTTTGTTTCTGCATCTGCACTACTAGTTATGATTAAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link