plrg1

Ensembl ID:
ENSDARG00000037283
ZFIN ID:
ZDB-GENE-040426-2787
Description:
pleiotropic regulator 1 [Source:RefSeq peptide;Acc:NP_998605]
Human Orthologue:
PLRG1
Human Description:
pleiotropic regulator 1 (PRL1 homolog, Arabidopsis) [Source:HGNC Symbol;Acc:9089]
Mouse Orthologue:
Plrg1
Mouse Description:
pleiotropic regulator 1, PRL1 homolog (Arabidopsis) Gene [Source:MGI Symbol;Acc:MGI:1858197]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13503 Nonsense Available for shipment Available now
sa38266 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24845 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054235 Nonsense 98 511 4 15
ENSDART00000123032 Nonsense 98 265 4 16
ENSDART00000125834 Nonsense 105 519 4 16
ENSDART00000131111 Nonsense 98 510 4 17
Genomic Location (Zv9):
Chromosome 1 (position 24512254)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24964025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGTGCAGACACTACTCCAGAATATTTGGTGACAGGAACACACCCTTA[T/A]CCATCTGCTCCAGGTWGAACCAGGATTTTTTTACTTATTTAGCCTAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054235 Essential Splice Site 276 511 None 15
ENSDART00000123032 Essential Splice Site None 265 None 16
ENSDART00000125834 Essential Splice Site 283 519 None 16
ENSDART00000131111 Essential Splice Site 276 510 None 17
Genomic Location (Zv9):
Chromosome 1 (position 24518175)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24969946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGGCGAGGACAAACAGGTTAAATGCTGGGACCTCGAGTATAATAAGG[T/C]ATGAGCTTTATATATATCACCACTGTCATACTCCATTTAGGTTTACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054235 Nonsense 442 511 14 15
ENSDART00000123032   None 265 15 16
ENSDART00000125834 Nonsense 450 519 14 16
ENSDART00000131111 Nonsense 441 510 16 17
Genomic Location (Zv9):
Chromosome 1 (position 24522543)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24974314
KASP Assay ID:
554-7460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAGCTGATAACGGCACTATTCACATGTGGGATTGGAGAACTGGCTA[T/G]AACTTCCAGAGGATTCATGCAGCGGTGCAGCCTGGTTCTCTGGACAGCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Fibrinogen: Assessment of genetic determinants of the association of γ' fibrinogen in relation to cardiovascular disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link