fgg

Ensembl ID:
ENSDARG00000037281
ZFIN ID:
ZDB-GENE-040426-1998
Description:
fibrinogen gamma polypeptide [Source:RefSeq peptide;Acc:NP_998219]
Human Orthologue:
FGG
Human Description:
fibrinogen gamma chain [Source:HGNC Symbol;Acc:3694]
Mouse Orthologue:
Fgg
Mouse Description:
fibrinogen gamma chain Gene [Source:MGI Symbol;Acc:MGI:95526]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6585 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054230 Nonsense 70 431 3 9
ENSDART00000127889 Nonsense 70 291 3 10

The following transcripts of ENSDARG00000037281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24535693)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 24987464
KASP Assay ID:
554-4978.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTACAAGCCTGATATGGACAAAAAGCTGGATGATAWGGAACAGGATT[T/A]GGAAGAGATCGCCAACCTCACCAGAGGAGCTCAAGACAAAGTGGTCTACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • D-dimer levels: Genetic predictors of fibrin D-dimer levels in healthy adults. (View Study)
  • Fibrinogen: Assessment of genetic determinants of the association of γ' fibrinogen in relation to cardiovascular disease. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)
  • Venous thromboembolism: Genetics of venous thrombosis: insights from a new genome wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link