fgg

Ensembl ID:
ENSDARG00000037281
ZFIN ID:
ZDB-GENE-040426-1998
Description:
fibrinogen gamma polypeptide [Source:RefSeq peptide;Acc:NP_998219]
Human Orthologue:
FGG
Human Description:
fibrinogen gamma chain [Source:HGNC Symbol;Acc:3694]
Mouse Orthologue:
Fgg
Mouse Description:
fibrinogen gamma chain Gene [Source:MGI Symbol;Acc:MGI:95526]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6585 Nonsense Mutation detected in F1 DNA During 2014
sa3375 Essential Splice Site Mutation detected in F1 DNA During 2014
sa2017 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6585
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054230 Nonsense 70 431 3 9
ENSDART00000127889 Nonsense 70 291 3 10

The following transcripts of ENSDARG00000037281 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 24535693)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGTACAAGCCTGATATGGACAAAAAGCTGGATGATAWGGAACAGGATT[T/A]GGAAGAGATCGCCAACCTCACCAGAGGAGCTCAAGACAAAGTGGTCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054230 Essential Splice Site 171 431 5 9
ENSDART00000127889 Essential Splice Site 171 291 5 10

The following transcripts of ENSDARG00000037281 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 24533409)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGAGCCCTGCAAAGACACTGTGGAGATTCAGACAGTCACTGGCAAAG[G/A]YAAAGATTTAAACTTGAGCAAAATTCATGTTTATGACAATTGACATGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054230 Essential Splice Site 172 431 5 9
ENSDART00000127889 Essential Splice Site 172 291 5 10

The following transcripts of ENSDARG00000037281 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 24533408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGAGCCCTGCAAAGACACTGTGGAGATTCAGACAGTCACTGGCAAAGR[T/C]AAAGATTTAAACTTGAGCAAAATTCATGTTTATGACAATTGACATGCATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • D-dimer levels: Genetic predictors of fibrin D-dimer levels in healthy adults. (View Study)
  • Fibrinogen: Assessment of genetic determinants of the association of γ' fibrinogen in relation to cardiovascular disease. (View Study)
  • Fibrinogen: Novel loci, including those related to Crohn disease, psoriasis, and inflammation, identified in a genome-wide association study of fibrinogen in 17 686 women: the Women's Genome Health Study. (View Study)
  • Venous thromboembolism: Genetics of venous thrombosis: insights from a new genome wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2uhpdw5u