si:ch73-34b5.1

Ensembl ID:
ENSDARG00000037276
ZFIN ID:
ZDB-GENE-080225-36
Human Orthologue:
MAP9
Human Description:
microtubule-associated protein 9 [Source:HGNC Symbol;Acc:26118]
Mouse Orthologue:
Mtap9
Mouse Description:
microtubule-associated protein 9 Gene [Source:MGI Symbol;Acc:MGI:2442208]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32682 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32681 Nonsense Mutation detected in F1 DNA During 2017
sa38267 Nonsense Mutation detected in F1 DNA During 2017
sa1974 Essential Splice Site F2 line generated During 2017
sa11352 Nonsense Available for shipment Available now
sa8871 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Essential Splice Site 269 678 3 13
ENSDART00000133937 Essential Splice Site 269 678 4 14
Genomic Location (Zv9):
Chromosome 1 (position 24605406)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25057177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTGTTCCTCAACCCAGGGAAAGAACTGTTAAATCAAAATCGTCAGCAG[G/A]TTAGACCAGACATTTTAAAATTTTGCTAATTTTTTTATTTAAAATTAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 377 678 6 13
ENSDART00000133937 Nonsense 377 678 7 14
Genomic Location (Zv9):
Chromosome 1 (position 24603397)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25055168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGATTTTTCATTATAGCTGCCACAGAAGAGAGCAAAGAGAGAAATTA[T/A]TCTACATCCTTTGAAGAAAAGCCTGTAAGTCAGATGAAGTGTGAAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 423 678 8 13
ENSDART00000133937 Nonsense 423 678 9 14
Genomic Location (Zv9):
Chromosome 1 (position 24600415)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25052186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTTTAGGCCTTCAAGCTCTCAGTCAACCAGTTCCAGAAAGTCCAAGTG[T/A]TCTTATAAAGCAGAGTCCAAATACTTGGGAACACTGAAAATTTTGGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1974
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Essential Splice Site 462 678 9 13
ENSDART00000133937 Essential Splice Site 462 678 10 14
Genomic Location (Zv9):
Chromosome 1 (position 24600189)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25051960
KASP Assay ID:
554-2676.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATGGGGAAAAAGATTTTAATGCATCTAACATTTGTTTGAAAAATAAC[A/T]GGAATGGCTGAAAAAGAAAGAAGAAACCTTGGAAATTACTAGGAGGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
Genomic Location (Zv9):
Chromosome 1 (position 24599558)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25051329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTTCTAAAACTRCAGATGCAAAGGCCTCTTATGATGCCTGGAAAGAG[A/T]AAAAACGTGACGTCATAAGAAAGAAACTCAGCGAAAAACAGAAGCTAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
ENSDART00000054225 Nonsense 510 678 10 13
ENSDART00000133937 Nonsense 510 678 11 14
Genomic Location (Zv9):
Chromosome 1 (position 24599558)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25051329
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTTTCTAAAACTRCAGATGCAAAGGCCTCTTATGATGCCTGGAAAGAG[A/C]AAAAACGTGACGTCATAAGAAAGAAACTCAGCGAAAAACAGAAGCTAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link