cdkn2b

Ensembl ID:
ENSDARG00000037262
ZFIN ID:
ZDB-GENE-081104-306
Human Orthologues:
CDKN2A, CDKN2B
Human Descriptions:
cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) [Source:HGNC Symbol;Acc:1787]
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) [Source:HGNC Symbol;Acc:1788]
Mouse Orthologues:
Cdkn2a, Cdkn2b
Mouse Descriptions:
cyclin-dependent kinase inhibitor 2A Gene [Source:MGI Symbol;Acc:MGI:104738]
cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) Gene [Source:MGI Symbol;Acc:MGI:104737]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25583 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32685 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054209 Essential Splice Site 42 125 1 2
Genomic Location (Zv9):
Chromosome 1 (position 25013550)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25437248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGAGTGAATGCCAATGTGGTTAACAAATTTAGAAGAACGCCTATACAG[G/A]TAGGTTTAGACGCGCTTTAAGAATAAACAACGGAAATAAACAAATGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054209 Nonsense 105 125 2 2
Genomic Location (Zv9):
Chromosome 1 (position 25011706)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25435404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTAATCCGCTTCGGCGCCGACCCCAATACAAAAGATCACTGCGATTTA[C/T]GACCAGTGGATGTGGCACAACAGACTGGCAACGTAGACGTGGTTGAATTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link