mtap

Ensembl ID:
ENSDARG00000037261
ZFIN ID:
ZDB-GENE-040426-1505
Description:
S-methyl-5'-thioadenosine phosphorylase [Source:RefSeq peptide;Acc:NP_956848]
Human Orthologue:
MTAP
Human Description:
methylthioadenosine phosphorylase [Source:HGNC Symbol;Acc:7413]
Mouse Orthologue:
Mtap
Mouse Description:
methylthioadenosine phosphorylase Gene [Source:MGI Symbol;Acc:MGI:1914152]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39619 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054208 Essential Splice Site 37 280 2 8

The following transcripts of ENSDARG00000037261 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25001979)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25425677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCCTGGAGGGAAGGACAGAGCGGTATGTAGTCACACCATATGGAAAG[G/A]TAAGTGTGTCTCTTGCCAGCATGCATATAAGTGGACATTTGGAAATTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Coronary heart disease: A genome-wide association study identifies LIPA as a susceptibility gene for coronary artery disease. (View Study)
  • Cutaneous nevi: Genome-wide association study identifies variants at 9p21 and 22q13 associated with development of cutaneous nevi. (View Study)
  • Melanoma: Genome-wide association study identifies three new melanoma susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link