ndufb6

Ensembl ID:
ENSDARG00000037259
ZFIN ID:
ZDB-GENE-040426-1781
Description:
NADH dehydrogenase [Source:RefSeq peptide;Acc:NP_957102]
Human Orthologue:
NDUFB6
Human Description:
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa [Source:HGNC Symbol;Acc:7701]
Mouse Orthologue:
Ndufb6
Mouse Description:
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6 Gene [Source:MGI Symbol;Acc:MGI:2684983]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32684 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054205 Nonsense 85 128 2 4

The following transcripts of ENSDARG00000037259 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 24982305)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 25406003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTACAACCCTCAAGGTGGTTCTGCTCCCAGCCTGGGTCCTGCATTACTA[T/A]CTGAAATACCACGTCTCTGTAAGTTCTTAAATAGTTTATTTGTTCTTTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link