NP_001139235.1

Ensembl ID:
ENSDARG00000037195
Description:
thyrotropin receptor [Source:RefSeq peptide;Acc:NP_001139235]
Human Orthologue:
TSHR
Human Description:
thyroid stimulating hormone receptor [Source:HGNC Symbol;Acc:12373]
Mouse Orthologue:
Tshr
Mouse Description:
thyroid stimulating hormone receptor Gene [Source:MGI Symbol;Acc:MGI:98849]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36962 Nonsense Mutation detected in F1 DNA During 2017
sa5947 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12444 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054086 Nonsense 277 757 9 10
Genomic Location (Zv9):
Chromosome 20 (position 6124722)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6030086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCACCAATCAAGACTTTTAGACACCTAGTTACAGCAGACTTGACCTA[C/A]CCCAGCCACTGCTGTGCGTTCAAGAATTTGAAGAAAAAACGGGGGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054086 Essential Splice Site 292 757 9 10
Genomic Location (Zv9):
Chromosome 20 (position 6124767)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6030131
KASP Assay ID:
554-3867.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTACCCCAGCCACTGCTGTGCGTTCAAGAATTTGAAGAAAAAACGGGG[G/A]TGTGTGGCTACAGTCTRAATTATTKTATGTTAGATCAGTAAATATATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054086 Nonsense 304 757 10 10
Genomic Location (Zv9):
Chromosome 20 (position 6129622)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6034986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTYGCTTCTGGCAGGTTCATAGAGGAAATCATTTGTAACCTGACTGCY[C/T]GAAAGAATCAAGTTCAAAAGAGATCYGTGAGAGCTTTCACAATTCMCGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link