rpa2

Ensembl ID:
ENSDARG00000037188
ZFIN ID:
ZDB-GENE-010131-3
Description:
replication protein A 32 kDa subunit [Source:RefSeq peptide;Acc:NP_571786]
Human Orthologues:
RPA2, RPA4
Human Descriptions:
replication protein A2, 32kDa [Source:HGNC Symbol;Acc:10290]
replication protein A4, 30kDa [Source:HGNC Symbol;Acc:30305]
Mouse Orthologue:
Rpa2
Mouse Description:
replication protein A2 Gene [Source:MGI Symbol;Acc:MGI:1339939]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28573 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054078 Essential Splice Site 243 271 8 9
Genomic Location (Zv9):
Chromosome 16 (position 5696639)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4922622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGAACTCAAGCAGAAGCTCAACAGCATGAGCGCCAACGTCATCAGG[T/C]ACAAACTTCTCCTTCCGAGATAAGCCTCTGTTAAGAACGACCTTCTATAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link