LOC100330676

Ensembl ID:
ENSDARG00000037183
Human Orthologue:
FAM46A
Human Description:
family with sequence similarity 46, member A [Source:HGNC Symbol;Acc:18345]
Mouse Orthologue:
Fam46a
Mouse Description:
family with sequence similarity 46, member A Gene [Source:MGI Symbol;Acc:MGI:2670964]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16593 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16593
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054071 Nonsense 272 404 2 2
Genomic Location:
Chromosome 16 (position 5860243)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAATACTGCCATCTGCTGGTCAGGGGTTTCCGCGCCGCCTCCGAGTCT[G/T]AAATGAAGTCTCTYCAGCGCTACATGTGCTCCCGCTTCTTCATCGAYTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer: A meta-analysis of genome-wide association studies of breast cancer identifies two novel susceptibility loci at 6q14 and 20q11. (View Study)
  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aq39zoob