si:dkey-18h14.3

Ensembl ID:
ENSDARG00000037154
ZFIN ID:
ZDB-GENE-100922-42
Human Orthologue:
HIVEP3
Human Description:
human immunodeficiency virus type I enhancer binding protein 3 [Source:HGNC Symbol;Acc:13561]
Mouse Orthologue:
Hivep3
Mouse Description:
human immunodeficiency virus type I enhancer binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:10658

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28701 Nonsense Mutation detected in F1 DNA During 2017
sa36204 Nonsense Mutation detected in F1 DNA During 2017
sa39118 Nonsense Mutation detected in F1 DNA During 2017
sa42776 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36203 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42775 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054020 Nonsense 91 1439 1 7
ENSDART00000110258   None 580 None 9
ENSDART00000142223   None 694 None 6
Genomic Location (Zv9):
Chromosome 16 (position 36759101)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34387722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGGAAACAAGTTTTATTGGGCCAGAAGGTGCAGTCTTGGGTGAAGAA[C/T]AAGAAGAGGGTACGGAGGGAGAGAGTACAGGTTCTGAGGATGAGACAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054020 Nonsense 559 1439 3 7
ENSDART00000110258   None 580 None 9
ENSDART00000142223   None 694 None 6
Genomic Location (Zv9):
Chromosome 16 (position 36757618)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34386239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGAACATGAGCCATCACAGGAGCCAAAACCAACCTCTACTTCCCGGT[T/A]AATTCGTCAATCCAACATTCAAGTTCCAGAAATTCTTGTTACAGAGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054020 Nonsense 870 1439 3 7
ENSDART00000110258   None 580 None 9
ENSDART00000142223   None 694 None 6
Genomic Location (Zv9):
Chromosome 16 (position 36756684)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34385305
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTACCTTCACAGTGAGACACCTCCGGTAAATCAAAGACCCACAGAGTA[T/A]GTAGAACGCCTGCCCCTTCAGCCACTCGCAACTTTATTCCCGCTACAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054020 Essential Splice Site 1361 1439 5 7
ENSDART00000110258 Essential Splice Site 201 580 3 9
ENSDART00000142223 Essential Splice Site 226 694 3 6
Genomic Location (Zv9):
Chromosome 16 (position 36748682)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34377303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGTCCGTATGTCTGCAAGTACTGCAACTTCGCCTTTAAAACCAAAGG[T/C]AGACATACATTCAAACTCATCCTATCATCTCTTTAAAGGCTCACGTTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36203
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054020 Essential Splice Site 1393 1439 6 7
ENSDART00000110258 Essential Splice Site 233 580 4 9
ENSDART00000142223 Essential Splice Site 258 694 4 6
Genomic Location (Zv9):
Chromosome 16 (position 36748496)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34377117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGATGGGAGCATCCGAGTCCTCTGAGCTGGACCCTGAGGAAGCAGG[T/A]AATGTTAACAAAAAGATTGTACGTAAAGTTGAAAAAAAATAATAATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054020   None 1439 None 7
ENSDART00000110258 Essential Splice Site 437 580 5 9
ENSDART00000142223 Essential Splice Site 462 694 5 6
Genomic Location (Zv9):
Chromosome 16 (position 36742523)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 34371144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGGCCTCCACTGGGAGCCCAGCAAACCAGCTACTAACACTCAAAAGG[T/C]AGGCAATGTAACAATTTAAAGGGGTCTTGTTATGCTGGGTTTTTACGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link