atp6ap1

Ensembl ID:
ENSDARG00000037153
ZFIN ID:
ZDB-GENE-020423-2
Description:
ATPase, H+ transporting, lysosomal accessory protein 1 [Source:RefSeq peptide;Acc:NP_775372]
Human Orthologue:
ATP6AP1
Human Description:
ATPase, H+ transporting, lysosomal accessory protein 1 [Source:HGNC Symbol;Acc:868]
Mouse Orthologue:
Atp6ap1
Mouse Description:
ATPase, H+ transporting, lysosomal accessory protein 1 Gene [Source:MGI Symbol;Acc:MGI:109629]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24346 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054013 Essential Splice Site 185 459 6 11
ENSDART00000129617 Essential Splice Site 185 459 6 10
Genomic Location:
Chromosome 23 (position 26371078)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACATGCTAATCAATATTGTCCTAAAGTAAGATTTCACTTCTATTATAA[G/A]ATATGATCATCGGAGAGGTGCTTGACATGTTTAAATCTCAGGACATGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/82p75whx