cpb2

Ensembl ID:
ENSDARG00000037144
ZFIN ID:
ZDB-GENE-050522-259
Description:
carboxypeptidase B2 [Source:RefSeq peptide;Acc:NP_001018539]
Human Orthologue:
CPB2
Human Description:
carboxypeptidase B2 (plasma) [Source:HGNC Symbol;Acc:2300]
Mouse Orthologue:
Cpb2
Mouse Description:
carboxypeptidase B2 (plasma) Gene [Source:MGI Symbol;Acc:MGI:1891837]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6593 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054059 Nonsense 121 424 4 11
ENSDART00000101856 Nonsense 121 355 4 10
Genomic Location:
Chromosome 1 (position 28706654)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCAGATCAGAAATGATACATCAGATCCCCGAAGCGGAGGCGTCTTYTA[T/A]GAGAGATATCWTTCCTTAGAAGATGTAAACAAAAAAAATCACTTTAACAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i30v5wqt