pfkfb1

Ensembl ID:
ENSDARG00000037140
ZFIN ID:
ZDB-GENE-030131-5664
Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 [Source:RefSeq peptide;Acc:NP_956102]
Human Orthologue:
PFKFB1
Human Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 [Source:HGNC Symbol;Acc:8872]
Mouse Orthologue:
Pfkfb1
Mouse Description:
6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 Gene [Source:MGI Symbol;Acc:MGI:107816]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5979 Nonsense Mutation detected in F1 DNA During 2017
sa37720 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa5979
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002939 Nonsense 167 457 7 14
ENSDART00000141553 Nonsense 180 470 7 14
Genomic Location (Zv9):
Chromosome 23 (position 26320555)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26106675
KASP Assay ID:
554-3669.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTTTTATTTAATGGATTTTGACAGCAAGTAAAATTGAGCAGCCCAGATTA[T/G]GAAAACTACGACAAAGAAGAAGCACTGGTGGACTTTCTGAAGCGCATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002939 Nonsense 203 457 8 14
ENSDART00000141553 Nonsense 216 470 8 14
Genomic Location (Zv9):
Chromosome 23 (position 26320794)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 26106914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTCCTCCCCTTTTGCCTGTGTATCTGCTTTATAGTCACCTTTCCTA[C/A]ATTAAGATCTTCAACGTAGGATCCAGGTACCTTGTGAATCGGGTTCAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link