B8A5G1_DANRE

Ensembl ID:
ENSDARG00000037122
Description:
Novel protein similar to vertebrate odz, odd Oz/ten-m homolog 2 (Drosophila) (ODZ2) [Source:UniProtK
Human Orthologue:
ODZ2
Human Description:
odz, odd Oz/ten-m homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29943]
Mouse Orthologue:
Odz2
Mouse Description:
odd Oz/ten-m homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1345184]

Alleles

There are 15 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13488 Nonsense Available for shipment Available now
sa22492 Nonsense Mutation detected in F1 DNA During 2014
sa17807 Nonsense Available for shipment Available now
sa22493 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11224 Nonsense Available for shipment Available now
sa7745 Nonsense Mutation detected in F1 DNA During 2014
sa1449 Nonsense F2 line generated During 2014
sa22494 Nonsense Available for shipment Available now
sa18320 Nonsense Available for shipment Available now
sa22495 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15917 Nonsense Available for shipment Available now
sa22496 Nonsense Mutation detected in F1 DNA During 2014
sa22497 Nonsense Mutation detected in F1 DNA During 2014
sa22498 Nonsense Mutation detected in F1 DNA During 2014
sa1714 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 291 2694 4 28
Genomic Location:
Chromosome 14 (position 30508991)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACAGTATATTCACCACCTCCACGGCTCCTACCCAGAAACACCTTCTCC[A/T]GAAGCGCCTTCAAGCTGAAGAAGCCGTCCAAGTACTGCAGCTGGAAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 305 2694 4 28
Genomic Location:
Chromosome 14 (position 30509034)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCCAGAAGCGCCTTCAAGCTGAAGAAGCCGTCCAAGTACTGCAGCT[G/A]GAAATGTGCAGCCCTGTCGGCGATCGCTGCTGCCGCCCTGCTGGCCATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17807
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 368 2694 5 28
Genomic Location:
Chromosome 14 (position 30551888)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCGGGCTGCCCAGCAACAGTGACRTAGCAAYAWCGCCCTCTGGAGGC[A/T]GAGGTGAGCAGCACAGCCTGCAGTCCTGCACGCTTTTTACCATAAGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Essential Splice Site 537 2694 9 28
Genomic Location:
Chromosome 14 (position 30570154)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATCAAACCCTTATTCTCTCTCCTTGTTATATTTCTGTTTCTTTTAA[A/C]GCGGCATGTCCTGTCCTCTGCAGTGGAAATGGTCAGTACGACAAGGGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 686 2694 11 28
Genomic Location:
Chromosome 14 (position 30582027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTGCTCGGTTGACTGCGGTACACACGGCGTATGCATGGGCGGTTCTTG[C/A]CGCTGTGAGGAAGGCTGGACAGGCGCAGCTTGTGACCAGCGTGTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7745
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 810 2694 13 28
Genomic Location:
Chromosome 14 (position 30596548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGTCCCTGCCAGAATAGTCCACTTTGTAGAGGATCAAGGGATCCCTTA[C/T]AGGTCATCCAGCAGGGTCAGCATCCTGAGCAGAAAGTCCGTTCCTTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1449
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1411 2694 22 28
Genomic Location:
Chromosome 14 (position 30616168)
KASP Assay ID:
554-1375.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCTGGAAAGTGCCACTGCTATCGGCATCTCCCATACAGGAGTRCTTTA[C/A]ATCGCAGAGACGGATGAGAAGAAGATCAACCGTGTGCGGCAAGTCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1441 2694 22 28
Genomic Location:
Chromosome 14 (position 30616256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAAGTCAGCACCAATGGAGAGATGTCGCTTTTAGCTGGCGCTACATCA[G/T]AATGCGACTGTAAGAATGACGTCAACTGCAACTGTTTCGCAGGAGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18320
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1616 2694 22 28
Genomic Location:
Chromosome 14 (position 30616782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAACCAGGAGATYKTTCTACTGGGRTACAATGGAAACACTGGCCTTT[T/A]GGCTACCAAGGCTGATGAGACAGGCTGGACAACTTTTTATGAGTAAGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Essential Splice Site 1767 2694 24 28
Genomic Location:
Chromosome 14 (position 30621690)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAGCTGTCCAAGGGCAAGGTCACTGTGTTCGGGAGGAAACTTCGGG[T/C]GGGCACTCCTTTTAGGATAATGATATCTCTCTACTCTTACACGTTATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 1851 2694 25 28
Genomic Location:
Chromosome 14 (position 30622025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGTATGAGTGAAAGAACAGAGTTTGAWGCACAGGGTCGARTCCTCTCA[C/T]GATCTTTTGTTRATGGAAAAGTGTGGAGCTACARTTAYCTAGACAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2151 2694 26 28
Genomic Location:
Chromosome 14 (position 30624457)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGACAACTCAGTGGTGTCAAGGTCAATGACTGGTCTACTTGGCGCTA[C/A]AGCTATGACTTAAACGGCAACTTACACCTGCTTAACCCAGGCAACAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2169 2694 26 28
Genomic Location:
Chromosome 14 (position 30624509)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATGACTTAAACGGCAACTTACACCTGCTTAACCCAGGCAACAGTGCC[C/T]GACTCATGCCCCTCCGCTATGACCTACGTGACCGTATCACACGCCTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2193 2694 26 28
Genomic Location:
Chromosome 14 (position 30624581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTACGTGACCGTATCACACGCCTTGGTGATGTCCAGTATCGTCTAGAT[G/T]AAGATGGCTACCTAAGTCAAAGAGGCAGCGATGTGTTTGACTACAACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043058 Nonsense 2522 2694 28 28
Genomic Location:
Chromosome 14 (position 30627621)
KASP Assay ID:
554-1660.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCCGTGTGGTCACWGGAGTCTCCAGCATGGCCAGCGATGACAGCAGG[A/T]AGGTGGTTCTGGTGTTAAATGGCGCAGTATATTTAGRCGGGACGCACTAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/osaoo9a7