cxcl12a

Ensembl ID:
ENSDARG00000037116
ZFIN ID:
ZDB-GENE-030318-1
Description:
chemokine (C-X-C motif) ligand 12a (stromal cell-derived factor 1) [Source:RefSeq peptide;Acc:NP_84
Human Orthologue:
CXCL12
Human Description:
chemokine (C-X-C motif) ligand 12 [Source:HGNC Symbol;Acc:10672]
Mouse Orthologue:
Cxcl12
Mouse Description:
chemokine (C-X-C motif) ligand 12 Gene [Source:MGI Symbol;Acc:MGI:103556]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12849 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12849
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053946 Nonsense 34 99 2 4
Genomic Location:
Chromosome 13 (position 31030203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAATTCTTCTCCAGCCAAGCCCATCAGCCTGGTAGAGAGATGCTGGTG[C/A]CGTTCCACAGTCAACACAGTCCCACAGAGAAGCATTCGCGAGCTCAAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pj4frll9