pwp2h

Ensembl ID:
ENSDARG00000037109
ZFIN ID:
ZDB-GENE-021031-3
Description:
periodic tryptophan protein 2 homolog [Source:RefSeq peptide;Acc:NP_998212]
Human Orthologue:
PWP2
Human Description:
PWP2 periodic tryptophan protein homolog (yeast) [Source:HGNC Symbol;Acc:9711]
Mouse Orthologue:
Pwp2
Mouse Description:
PWP2 periodic tryptophan protein homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1341200]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19511 Essential Splice Site Available for shipment Available now
sa18575 Nonsense Available for shipment Available now
sa14829 Nonsense Mutation detected in F1 DNA During 2017
sa32693 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110270 Essential Splice Site 44 937 2 21

The following transcripts of ENSDARG00000037109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 27880588)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28146146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCATCAGTCCTGTAGGCAACCGCATCTCCGTCTTTGATCTGAAAAA[G/A]TAAGTATCACACGTTTCACTGCCCGACTAAGTTTATTGGGTCGTGAGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18575
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110270 Nonsense 224 937 7 21

The following transcripts of ENSDARG00000037109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 27860342)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28125900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGAAGGCACTTTATGTATATGGGAAAGTGACACTGATCTAGAAGGCT[T/A]ACGAAAGGGCCCAAAATACGCTGAGAGAAAGGAAAAGGAGCAGAAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110270 Nonsense 286 937 7 21

The following transcripts of ENSDARG00000037109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 27860155)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28125713
KASP Assay ID:
1641-0485.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGTGCMGAAACACCTRAAGAAGTGGAAGGCATAAAAAATGTTCGTTA[T/A]TTACAGAAAAGCAAGTGAGTATGTTTTGATTTATCCTAATCTCTTCAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110270 Nonsense 393 937 10 21

The following transcripts of ENSDARG00000037109 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 27854791)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 28120349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGTTTAAACAGCAAGGACACTTTAACAACATGAACTCTTTGGCTTA[T/A]TCACCTGATGGTCAGTATCTTGCTACTGGAGGGGATGATGGCAAGGTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link