mtmr7a

Ensembl ID:
ENSDARG00000037101
ZFIN ID:
ZDB-GENE-060421-7754
Description:
myotubularin-related protein 7 [Source:RefSeq peptide;Acc:NP_001035406]
Human Orthologue:
MTMR7
Human Description:
myotubularin related protein 7 [Source:HGNC Symbol;Acc:7454]
Mouse Orthologue:
Mtmr7
Mouse Description:
myotubularin related protein 7 Gene [Source:MGI Symbol;Acc:MGI:1891693]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28321 Essential Splice Site Mutation detected in F1 DNA During 2015
sa28322 Nonsense Mutation detected in F1 DNA During 2015
sa11085 Nonsense Available for shipment Available now
sa10690 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053925 Essential Splice Site 49 655 2 14
Genomic Location:
Chromosome 14 (position 31268859)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACTATCTTTGTAGGTAAAGGATCTGAGGACCGAAATGAGCTTTGGG[T/A]AAGTTCTTGCCTGCCGTACCACAATATTTTCCTTTTTTCACTAAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053925 Nonsense 338 655 9 14
Genomic Location:
Chromosome 14 (position 31277185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACACACTCAGGCTGTGGCAGATGAAGGTGTCAGTGTCTTGGTTCATTG[T/A]TCTGACGGCTGGGACAGGACGTCTCAGGTGTGCTCTGTGGCCAGTGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11085
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053925 Nonsense 441 655 11 14
Genomic Location:
Chromosome 14 (position 31279205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAGCATCCACAACCACGTTTACTCCAGCCACTACGGCAACTTCATTTG[T/A]AACAGCCWGAAGGAGAGGAAAGAWCTGCGGTAACTCTCCCGTTTGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053925 Nonsense 654 655 14 14
Genomic Location:
Chromosome 14 (position 31281076)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGCCAAGTGAGGACAGTGTGAAAGACTCAGACGAGACTGGACACAAC[A/T]GAGCCTGAACAAATGCAAGTCTGCAAAAAGCAAACACTAATGTGTCTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ro7odwoa