asah1a

Ensembl ID:
ENSDARG00000037091
ZFIN ID:
ZDB-GENE-041010-191
Description:
N-acylsphingosine amidohydrolase 1 [Source:RefSeq peptide;Acc:NP_001006088]
Human Orthologue:
ASAH1
Human Description:
N-acylsphingosine amidohydrolase (acid ceramidase) 1 [Source:HGNC Symbol;Acc:735]
Mouse Orthologue:
Asah1
Mouse Description:
N-acylsphingosine amidohydrolase 1 Gene [Source:MGI Symbol;Acc:MGI:1277124]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1537 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1537
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017122 Nonsense 196 390 8 14

The following transcripts of ENSDARG00000037091 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 31144248)
KASP Assay ID:
554-1460.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGGTGAACATCAATTTCGAAAGGAAAAACCAAACAGTCTTTAAAT[C/A]RACAAGTTTTGCTGGATATGTTGGCATGCTCACTGGAATTAGACCTGTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3p1vtdmp