si:ch211-199l3.1

Ensembl ID:
ENSDARG00000037069
ZFIN ID:
ZDB-GENE-040724-21
Description:
probable palmitoyltransferase ZDHHC14 [Source:RefSeq peptide;Acc:NP_001038652]
Human Orthologue:
ZDHHC14
Human Description:
zinc finger, DHHC-type containing 14 [Source:HGNC Symbol;Acc:20341]
Mouse Orthologue:
Zdhhc14
Mouse Description:
zinc finger, DHHC domain containing 14 Gene [Source:MGI Symbol;Acc:MGI:2653229]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4879 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa4879
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053877 Nonsense 206 513 4 10
ENSDART00000145540 Nonsense 206 513 4 10
Genomic Location (Zv9):
Chromosome 20 (position 4899264)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4814631
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGATCATCACTGCCCGTGGGTGGGCAACTGCGTGGGGAGGAGGAACTA[T/A]CGCTTCTTCTACCTGTTCATCCTCTCGCTCTCCTTCCTCACCATCTTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link