dnajc22

Ensembl ID:
ENSDARG00000037067
ZFIN ID:
ZDB-GENE-090313-196
Human Orthologue:
DNAJC22
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 22 [Source:HGNC Symbol;Acc:25802]
Mouse Orthologue:
Dnajc22
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 22 Gene [Source:MGI Symbol;Acc:MGI:1920028]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10567 Essential Splice Site Available for shipment Available now
sa13487 Nonsense Available for shipment Available now
sa32446 Nonsense Available for shipment Available now
sa30742 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10567
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053876 Essential Splice Site None 338 2 4
Genomic Location (Zv9):
Chromosome 23 (position 27942026)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27774848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACANTCTTTTTTTCCAGAGTAAAAACCTTCCCTCATTACAACTTTTTTC[A/T]GCTTCTGTGTGCAGCTAGAATGACCTCATGGCTAAGAAGCTCATGATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053876 Nonsense 248 338 3 4
Genomic Location (Zv9):
Chromosome 23 (position 27938092)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27770914
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGTCCTGGAGTATTTTCTCCTGTTGYCATMTCGTCTGCTATGCCTCT[T/A]AACAGGAGGAGRTTTCTATGMGGAAAGCYGGAGGAAGATGCTTGAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053876 Nonsense 263 338 3 4
Genomic Location (Zv9):
Chromosome 23 (position 27938048)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27770870
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTTAACAGGAGGAGGTTTCTATGAGGAAAGCTGGAGGAAGATGCTT[G/T]AAATAATTCTTAATGAGTTTAGTAAGAAAGAAATGGAAGCACTGAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053876 Nonsense 272 338 3 4
Genomic Location (Zv9):
Chromosome 23 (position 27938021)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27770843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAAGCTGGAGGAAGATGCTTGAAATAATTCTTAATGAGTTTAGTAAG[A/T]AAGAAATGGAAGCACTGAAGGTGAGTTCAGAAGGCCTAGTTTTAATTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link