galca

Ensembl ID:
ENSDARG00000037064
ZFIN ID:
ZDB-GENE-040724-243
Description:
Galactocerebrosidase [Source:UniProtKB/Swiss-Prot;Acc:Q5SNX7]
Human Orthologue:
GALC
Human Description:
galactosylceramidase [Source:HGNC Symbol;Acc:4115]
Mouse Orthologue:
Galc
Mouse Description:
galactosylceramidase Gene [Source:MGI Symbol;Acc:MGI:95636]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25131 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053870 Nonsense 242 660 8 17
Genomic Location (Zv9):
Chromosome 20 (position 4828616)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4743983
KASP Assay ID:
554-7346.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTACAGTGTCCACTACCCAGGAACCAACACAGTAAAGGAAGCTCTGT[T/A]GACGGAGAGAAAGCTCTGGTCATCTGAAGACTACAGCACCTACAATGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link