aldh9a1b

Ensembl ID:
ENSDARG00000037061
ZFIN ID:
ZDB-GENE-040120-5
Description:
Aldehyde dehydrogenase family 9 member A1-B [Source:UniProtKB/Swiss-Prot;Acc:Q802W2]
Human Orthologue:
ALDH9A1
Human Description:
aldehyde dehydrogenase 9 family, member A1 [Source:HGNC Symbol;Acc:412]
Mouse Orthologue:
Aldh9a1
Mouse Description:
aldehyde dehydrogenase 9, subfamily A1 Gene [Source:MGI Symbol;Acc:MGI:1861622]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9137 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053868 Essential Splice Site None 518 1 12
ENSDART00000145244 None None 109 1 2
Genomic Location:
Chromosome 2 (position 5709789)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGAATGCTCGAACATGGCTGGACTGATCTGAAATCTTCAGAGGAGKAG[G/A]TGGGTGGACGACTCAATCCGTTAAACCYTTTTTTCTTGMTAGTCTTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1tequ0wy