mll2

Ensembl ID:
ENSDARG00000037060
ZFIN ID:
ZDB-GENE-060223-2
Human Orthologue:
MLL2
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 2 [Source:HGNC Symbol;Acc:7133]
Mouse Orthologue:
Mll2
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 2 Gene [Source:MGI Symbol;Acc:MGI:2682319]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14115 Essential Splice Site Available for shipment Available now
sa5980 Nonsense Mutation detected in F1 DNA During 2014
sa16818 Nonsense Available for shipment Available now
sa5057 Nonsense Mutation detected in F1 DNA During 2014
sa10227 Nonsense Available for shipment Available now
sa8019 Nonsense Mutation detected in F1 DNA During 2014
sa4249 Nonsense Mutation detected in F1 DNA During 2014
sa24354 Nonsense Mutation detected in F1 DNA During 2014
sa24355 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14115
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Essential Splice Site 213 4967 5 53
ENSDART00000131379 None None 461 None 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 Essential Splice Site 213 368 6 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28008203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCTGGCGCTCCTYTGTCCAGAGCACATAGACAAGGCTGAGGAGATTGG[T/A]ACGGAATTGCAGAAGAAGAGATGCGATATGATCAGTAAATAAHGATCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 1986 4967 30 53
ENSDART00000131379 None None 461 None 6
ENSDART00000134785 Nonsense 84 235 1 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28020336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAAATGGGCCCGCAACAAATAGTTGGCCAACAGCATATGACTCCTCAG[C/T]AAGCTCAGGTTCACCTCCAGCAGCCACAGTCCCAGACTCAACAAGTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16818
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 2316 4967 33 53
ENSDART00000131379 None None 461 None 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28021800)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGATCCCAGACTTGGGTTACAGCAGGGTGGCATGGACCTATTGATGCAA[C/T]AACAAAGCAATGCACCTCCTCCTCAGTCTCAACTACAGCCACAGCAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 2722 4967 33 53
ENSDART00000131379 Nonsense 105 461 1 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28023018)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGATTAGTGCTGCAATGCCTTCACCTCCCCATGCGGCAATGGGACAG[C/T]AGCCAGGCATTTTAAGGGGTGGCCAGCCTGGCAGACTTCATCCTGGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 2746 4967 33 53
ENSDART00000131379 Nonsense 129 461 1 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28023090)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGCCTGGCAGACTTCATCCTGGTCTTGCTCCACAGCAGCAGWCAACA[C/T]AACCTCCACATATTGGTAAACAGCAGAACTTTTTCCCAGATAAAGGTTTK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8019
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 3404 4967 38 53
ENSDART00000131379 None None 461 None 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28025675)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTAGCTGTCCAAAATAGCGGTCAGACAATGGGKAACMTTACAAATCAA[C/T]AGCAGCAAGCTCWACTGACTCAACAGATGGGCATTCCTAGAGCACAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 3566 4967 38 53
ENSDART00000131379 None None 461 None 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28026161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAGCCTTCTCAAGGACCTTTGCCTCAGTACATCAATAGTGCCCAGCAG[C/T]AGCAAATGATACAGCAGCAACAAGTGCATCAGCATCAAATGATGAGGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 3706 4967 38 53
ENSDART00000131379 None None 461 None 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28026581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCACCTTCAAGGCCAGAAGGTATTGTAGGAAAGAGTAGCCCCTTTAGC[C/T]AGACGGGGGGTTTGATACCTTCACCTCTGAGATCTCCAACTGCCAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053863 Nonsense 4406 4967 47 53
ENSDART00000131379 None None 461 None 6
ENSDART00000134785 None None 235 None 3
ENSDART00000137103 None None 368 None 9
ENSDART00000141458 None None 308 None 7
Genomic Location:
Chromosome 23 (position 28029669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTAAAATCCATCAAACACCGTAGCAGGCCTCTTTCTGATGAAGAACAA[C/T]GACCTAAGGTCAAAAAATGGAAAGGTTTGCGCTGGAAACGACTCCAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mhafrrwd