gcdh

Ensembl ID:
ENSDARG00000037057
ZFIN ID:
ZDB-GENE-040426-1855
Description:
glutaryl-Coenzyme A dehydrogenase [Source:RefSeq peptide;Acc:NP_957180]
Human Orthologue:
GCDH
Human Description:
glutaryl-CoA dehydrogenase [Source:HGNC Symbol;Acc:4189]
Mouse Orthologue:
Gcdh
Mouse Description:
glutaryl-Coenzyme A dehydrogenase Gene [Source:MGI Symbol;Acc:MGI:104541]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12642 Essential Splice Site Available for shipment Available now
sa13778 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12642
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053864 Essential Splice Site 215 441 None 11
ENSDART00000147793 Essential Splice Site 215 441 None 12

The following transcripts of ENSDARG00000037057 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 9476764)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACAACCCCTCCAGCAGAACTTACAGCATCAGTGGGACAAAAACATGG[T/C]AACCATGATGGTAACATGGTGTTCAGTTTGCATTGTCTGGCTTGGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053864 Nonsense 351 441 9 11
ENSDART00000147793 Nonsense 351 441 10 12

The following transcripts of ENSDARG00000037057 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 9472528)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCCAGAAGAAGATGGCAGACATGCTGACAGAAATTACAATCGGCCTG[C/T]AGTCCTGTTTACAACTGGGCAGACTCATTGACCAAAAAAAGTGAGTCCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wowacsyw