rad51l1

Ensembl ID:
ENSDARG00000037046
ZFIN ID:
ZDB-GENE-040426-2750
Description:
DNA repair protein RAD51 homolog 2 [Source:RefSeq peptide;Acc:NP_998577]
Human Orthologue:
RAD51L1
Human Description:
RAD51-like 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:9822]
Mouse Orthologue:
Rad51l1
Mouse Description:
RAD51-like 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1099436]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23643 Essential Splice Site Available for shipment Available now
sa43390 Nonsense Mutation detected in F1 DNA During 2017
sa31040 Nonsense Mutation detected in F1 DNA During 2017
sa43391 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Essential Splice Site 66 373 2 10
ENSDART00000138797   None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9653559)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9487688
KASP Assay ID:
2261-4004.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCTCCAGCGTCTGGTCAGTAAAGCCTGTGCTCCGGCTGTCATCACTG[T/A]AAGTTATTACCGCATTAAAAGTGTAGTACCCCAAAAAAAGAAAATGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Nonsense 199 373 6 10
ENSDART00000138797   None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9663587)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9498205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGGATGTCACCCAGGCTTGAGCGTCTGGAGGAGGACATCATTGCTTGT[C/T]GAGCGGGGCTGGTTATCTTGGATTCTGTGGCCTCTGTTGTGCGGAAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797   None 101 None 3
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797   None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9678270)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9510998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAACCAGATCACCACACATGTGGGCGAGAAGCTTCACTGTCCTCAGT[G/A]GAATCAGACAGATGGTAAGAACAGCCTCCCAATCGTCTAAACTTGAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797   None 101 None 3
ENSDART00000053847 Nonsense 268 373 7 10
ENSDART00000138797   None 101 None 3
Genomic Location (Zv9):
Chromosome 20 (position 9678270)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9510998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAACCAGATCACCACACATGTGGGCGAGAAGCTTCACTGTCCTCAGT[G/A]GAATCAGACAGATGGTAAGAACAGCCTCCCAATCGTCTAAACTTGAGTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link