psmc6

Ensembl ID:
ENSDARG00000037038
ZFIN ID:
ZDB-GENE-030131-304
Description:
26S protease regulatory subunit S10B [Source:RefSeq peptide;Acc:NP_001003832]
Human Orthologue:
PSMC6
Human Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 6 [Source:HGNC Symbol;Acc:9553]
Mouse Orthologue:
Psmc6
Mouse Description:
proteasome (prosome, macropain) 26S subunit, ATPase, 6 Gene [Source:MGI Symbol;Acc:MGI:1914339]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36983 Nonsense Mutation detected in F1 DNA During 2017
sa36984 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053834 Nonsense 10 389 1 14
ENSDART00000115134 Nonsense 10 269 1 15
Genomic Location (Zv9):
Chromosome 20 (position 9944258)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9776187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGAGAGCGAAGCGGCAGTGAACATGGCGGAAAACAGGGAGAAAGGTTTA[C/T]AAGACTACAGAAAGAAATTACTGGAGCATAAAGAGATTGACGGGCGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053834 Nonsense 63 389 3 14
ENSDART00000115134 Nonsense 63 269 3 15
Genomic Location (Zv9):
Chromosome 20 (position 9944895)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 9776824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTTAAATTGTTGCATTGTCTTTGTAGATTGTCGGTGAAGTGCTGAAA[C/T]AGCTGACTGAGGAGAAATGTAAGGCCAGATTCTCTTTATTGAGCTGTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link