casz1

Ensembl ID:
ENSDARG00000037030
ZFIN ID:
ZDB-GENE-060130-108
Human Orthologue:
CASZ1
Human Description:
castor zinc finger 1 [Source:HGNC Symbol;Acc:26002]
Mouse Orthologue:
Casz1
Mouse Description:
castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1196251]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14282 Essential Splice Site Available for shipment Available now
sa44005 Nonsense Mutation detected in F1 DNA During 2016
sa1888 Nonsense Available for shipment Available now
sa37743 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14282
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002812   None 1733 None 21
ENSDART00000148257 Essential Splice Site 174 1644 1 17
Genomic Location (Zv9):
Chromosome 23 (position 29246235)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29076802
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCCACCACTGAAGCCCCTCCTCGCCCAGCCCCCTTYACCCCACCAGG[T/C]AGCACCTTTTTCTTTYAGGATGATGCTATTAGTATTTGTATGTAAYATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002812 Nonsense 793 1733 9 21
ENSDART00000148257 Nonsense 803 1644 7 17
Genomic Location (Zv9):
Chromosome 23 (position 29222107)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29052674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCCACCGCTGCTCTGCCTCCAGCTAGCCGCATTTCGACGCTGCTGTCC[C/T]AGGCCCTGCCCAGCAATGTACCCATGGCCCTGGCACTTTCTAACAGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1888
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002812 Nonsense 984 1733 13 21
ENSDART00000148257 Nonsense 991 1644 10 17
Genomic Location (Zv9):
Chromosome 23 (position 29215845)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29046412
KASP Assay ID:
554-1878.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTGTTAATGTGTGCAGATGAATCCTGGTTTCTTCAACGCTCTGGATT[T/A]GAAGTCAGAGCTGGAGGGAGCTCAGGCAGCAGACGGCTCAGACGCAGCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37743
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002812 Essential Splice Site 1395 1733 19 21
ENSDART00000148257 Essential Splice Site 1430 1644 16 17
Genomic Location (Zv9):
Chromosome 23 (position 29204692)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 29035259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCGCAGTTGTACCAGCACCCCCGTAGGAAACGACAGTTCGCCAGCAG[G/A]TGAGTTGACCTCAGCAACAAGAAAATATCATGGCAGTTTTAGAATGAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link