nr3c2

Ensembl ID:
ENSDARG00000037025
ZFIN ID:
ZDB-GENE-060531-23
Description:
mineralocorticoid receptor [Source:RefSeq peptide;Acc:NP_001093873]
Human Orthologue:
NR3C2
Human Description:
nuclear receptor subfamily 3, group C, member 2 [Source:HGNC Symbol;Acc:7979]
Mouse Orthologue:
Nr3c2
Mouse Description:
nuclear receptor subfamily 3, group C, member 2 Gene [Source:MGI Symbol;Acc:MGI:99459]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13656 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053818   597 970 3 9
ENSDART00000125011 Essential Splice Site 602 974 None 11
ENSDART00000129932   10 383 1 7
Genomic Location (Zv9):
Chromosome 1 (position 36709050)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36268523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTTATTTGCTCTTRTTTCAGTGCGTCGCTGAGGCACACGTCTTCGAC[A/T]GCCAAAGTGTGTCTGGTGTGTGGAGACGAGGCGTCAGGAWGCCACTACGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Biochemical measures: Genome-wide association study of biochemical traits in Korcula Island, Croatia. (View Study)
  • Corneal structure: Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. (View Study)
  • Thyroid function: Meta-analysis of two genome-wide association studies identifies four genetic loci associated with thyroid function. (View Study)
  • Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link