kif1b

Ensembl ID:
ENSDARG00000037020
ZFIN ID:
ZDB-GENE-030820-1
Description:
kinesin-like protein KIF1B [Source:RefSeq peptide;Acc:NP_919363]
Human Orthologue:
KIF1B
Human Description:
kinesin family member 1B [Source:HGNC Symbol;Acc:16636]
Mouse Orthologues:
Gm1305, Kif1b
Mouse Descriptions:
kinesin family member 1B Gene [Source:MGI Symbol;Acc:MGI:108426]
predicted gene 1305 Gene [Source:MGI Symbol;Acc:MGI:2686151]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24361 Nonsense Mutation detected in F1 DNA During 2014
sa16498 Essential Splice Site Available for shipment Available now
sa19330 Nonsense Mutation detected in F1 DNA During 2014
sa8450 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 None None 1782 None 47
ENSDART00000050915 None None 1770 None 47
ENSDART00000053807 Nonsense 1074 1161 21 21
ENSDART00000141075 None None 1763 None 46
ENSDART00000146458 Nonsense 1074 1161 22 22
Genomic Location:
Chromosome 23 (position 29683219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACGAACGAGGTCGTAGTAACTCCTTTAACAGCAGCCAGCGAGCCT[C/A]GGACTCTACAGAGACCTTCAATTCTGGAAACCGGAAGCCCCCTCACCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Essential Splice Site 944 1782 25 47
ENSDART00000050915 Essential Splice Site 933 1770 25 47
ENSDART00000053807 None None 1161 None 21
ENSDART00000141075 Essential Splice Site 933 1763 24 46
ENSDART00000146458 None None 1161 None 22
Genomic Location:
Chromosome 23 (position 29674806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAGGACCCCTTCTATGATCGTTCTCCATGGTTCATCCTGGTGGGCAG[G/A]TTGGTGGTGACCACTGCTCAGGAGAAACCTAATAGATGAGGGCAGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Nonsense 1040 1782 28 47
ENSDART00000050915 Nonsense 1029 1770 28 47
ENSDART00000053807 None None 1161 None 21
ENSDART00000141075 Nonsense 1029 1763 27 46
ENSDART00000146458 None None 1161 None 22
Genomic Location:
Chromosome 23 (position 29666302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCTCTCTCTGGAGGAGCTGCGCATTGTAGAAGGTCAAGGTCAGAGTT[C/A]AGAGGTCATTACGCCTTCAGAGGAGATGAACAGAATCAATGAAATGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 None 1607 1782 43 47
ENSDART00000050915 None 1595 1770 43 47
ENSDART00000053807 None None 1161 None 21
ENSDART00000141075 Essential Splice Site 1595 1763 42 46
ENSDART00000146458 None None 1161 None 22
Genomic Location:
Chromosome 23 (position 29646308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCCACCCTCACACCCTCCTCCACCTGYCCCTCGCTCTCAGACTCCAG[G/A]TACACACTTCACACGCAAAAGCACTATTACTTCAAATTACAAGCTTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sy769z3y