kif1b

Ensembl ID:
ENSDARG00000037020
ZFIN ID:
ZDB-GENE-030820-1
Description:
kinesin-like protein KIF1B [Source:RefSeq peptide;Acc:NP_919363]
Human Orthologue:
KIF1B
Human Description:
kinesin family member 1B [Source:HGNC Symbol;Acc:16636]
Mouse Orthologues:
Gm1305, Kif1b
Mouse Descriptions:
kinesin family member 1B Gene [Source:MGI Symbol;Acc:MGI:108426]
predicted gene 1305 Gene [Source:MGI Symbol;Acc:MGI:2686151]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44009 Nonsense Mutation detected in F1 DNA During 2016
sa44008 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24361 Nonsense Mutation detected in F1 DNA During 2016
sa16498 Essential Splice Site Available for shipment Available now
sa19330 Nonsense Mutation detected in F1 DNA During 2016
sa44007 Nonsense Mutation detected in F1 DNA During 2016
sa37744 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8450 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Nonsense 194 1782 5 47
ENSDART00000050915 Nonsense 229 1770 7 47
ENSDART00000053807 Nonsense 229 1161 6 21
ENSDART00000141075 Nonsense 229 1763 6 46
ENSDART00000146458 Nonsense 229 1161 7 22
Genomic Location:
Chromosome 23 (position 29705972)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGTCGTTCTCACGCCGTCTTTACTATCGTTTTCACTCAGAGGAAGTA[C/A]GACAGCGAGACGGACCTCTCCACCGAGAAGGTTGGATATTTTACACCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Essential Splice Site 283 1782 9 47
ENSDART00000050915 Essential Splice Site 312 1770 10 47
ENSDART00000053807 Essential Splice Site 312 1161 9 21
ENSDART00000141075 Essential Splice Site 312 1763 9 46
ENSDART00000146458 Essential Splice Site 312 1161 10 22
Genomic Location:
Chromosome 23 (position 29702674)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCCTTACCGAGACTCAGTGTTGACATGGCTGCTAAGAGAGAATTTAG[G/A]TATGGATGACAATCCATAATGGCTGTTAATGATTAATCACATGGAGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24361
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447   None 1782 None 47
ENSDART00000050915   None 1770 None 47
ENSDART00000053807 Nonsense 1074 1161 21 21
ENSDART00000141075   None 1763 None 46
ENSDART00000146458 Nonsense 1074 1161 22 22
Genomic Location:
Chromosome 23 (position 29683219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACGAACGAGGTCGTAGTAACTCCTTTAACAGCAGCCAGCGAGCCT[C/A]GGACTCTACAGAGACCTTCAATTCTGGAAACCGGAAGCCCCCTCACCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16498
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Essential Splice Site 944 1782 25 47
ENSDART00000050915 Essential Splice Site 933 1770 25 47
ENSDART00000053807   None 1161 None 21
ENSDART00000141075 Essential Splice Site 933 1763 24 46
ENSDART00000146458   None 1161 None 22
Genomic Location:
Chromosome 23 (position 29674806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAGGACCCCTTCTATGATCGTTCTCCATGGTTCATCCTGGTGGGCAG[G/A]TTGGTGGTGACCACTGCTCAGGAGAAACCTAATAGATGAGGGCAGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Nonsense 1040 1782 28 47
ENSDART00000050915 Nonsense 1029 1770 28 47
ENSDART00000053807   None 1161 None 21
ENSDART00000141075 Nonsense 1029 1763 27 46
ENSDART00000146458   None 1161 None 22
Genomic Location:
Chromosome 23 (position 29666302)
KASP Assay ID:
554-7044.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCTCTCTCTGGAGGAGCTGCGCATTGTAGAAGGTCAAGGTCAGAGTT[C/A]AGAGGTCATTACGCCTTCAGAGGAGATGAACAGAATCAATGAAATGGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Nonsense 1171 1782 31 47
ENSDART00000050915 Nonsense 1159 1770 31 47
ENSDART00000053807   None 1161 None 21
ENSDART00000141075 Nonsense 1159 1763 30 46
ENSDART00000146458   None 1161 None 22
Genomic Location:
Chromosome 23 (position 29662686)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTGAAGTGTTTGGCCATTACCAGCAACACCCACTGCACATTCATGGA[C/T]AGGATGTGGTCAGGTAACATCCTGCTATCAGTGTTGTCCAGTGTTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37744
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447 Essential Splice Site 1549 1782 41 47
ENSDART00000050915 Essential Splice Site 1537 1770 41 47
ENSDART00000053807   None 1161 None 21
ENSDART00000141075 Essential Splice Site 1537 1763 40 46
ENSDART00000146458   None 1161 None 22
Genomic Location:
Chromosome 23 (position 29648536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGACATCGAGAGCTTGGTGGATCGAGAGAAGGAGCTGGCCACTAAGG[T/C]AAGTGCCACTTATTATTCTCCTCTGACATCAGCAAAACATGTTCACTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8450
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005447   1607 1782 43 47
ENSDART00000050915   1595 1770 43 47
ENSDART00000053807   None 1161 None 21
ENSDART00000141075 Essential Splice Site 1595 1763 42 46
ENSDART00000146458   None 1161 None 22
Genomic Location:
Chromosome 23 (position 29646308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGCCACCCTCACACCCTCCTCCACCTGYCCCTCGCTCTCAGACTCCAG[G/A]TACACACTTCACACGCAAAAGCACTATTACTTCAAATTACAAGCTTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link