gab1

Ensembl ID:
ENSDARG00000037018
ZFIN ID:
ZDB-GENE-040426-2674
Description:
GRB2-associated-binding protein 1 [Source:RefSeq peptide;Acc:NP_998522]
Human Orthologue:
GAB1
Human Description:
GRB2-associated binding protein 1 [Source:HGNC Symbol;Acc:4066]
Mouse Orthologue:
Gab1
Mouse Description:
growth factor receptor bound protein 2-associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:108088]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32710 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32710
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053806   None 405 None 9
ENSDART00000101740 Essential Splice Site 414 740 4 11
ENSDART00000134943   None 381 None 8
ENSDART00000140724 Essential Splice Site 390 716 3 10
Genomic Location (Zv9):
Chromosome 1 (position 35291565)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 34851423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGAAGCAACACCATTGGTACGGTGGATTCTTCACGTCTGCGTAAAGG[T/A]AAGAAAATATTATGTATTTCAGTCATGTGTGGTATTTTAACCTTCATTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association study identifies three new susceptibility loci for adult asthma in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link