ube4b

Ensembl ID:
ENSDARG00000037017
ZFIN ID:
ZDB-GENE-020205-1
Description:
ubiquitin conjugation factor E4 B [Source:RefSeq peptide;Acc:NP_919343]
Human Orthologue:
UBE4B
Human Description:
ubiquitination factor E4B (UFD2 homolog, yeast) [Source:HGNC Symbol;Acc:12500]
Mouse Orthologue:
Ube4b
Mouse Description:
ubiquitination factor E4B, UFD2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1927086]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11598 Essential Splice Site Available for shipment Available now
sa24363 Nonsense Mutation detected in F1 DNA During 2014
sa24362 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053804 Essential Splice Site 361 1183 9 27
ENSDART00000064236 None None 821 None 21
ENSDART00000121475 Essential Splice Site 361 1181 9 29
ENSDART00000122920 None None 821 None 20
ENSDART00000126384 Essential Splice Site 539 1362 11 29
Genomic Location:
Chromosome 23 (position 29774041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATACATTKTGAATGACACTGCCACCCCCTCTCTGTCTTTGCCCTCAAAC[A/G]GAGCCCCTCTTCAGYCCTCCCTGCTGGYTCCCTACATGCTGTGCCGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053804 Nonsense 970 1183 23 27
ENSDART00000064236 Nonsense 608 821 17 21
ENSDART00000121475 Nonsense 968 1181 25 29
ENSDART00000122920 Nonsense 608 821 16 20
ENSDART00000126384 Nonsense 1149 1362 25 29
Genomic Location:
Chromosome 23 (position 29757503)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTCTCAGTTGACTCAGGATGAGCGAGTGTCACGGTCTTACCTGGCTT[T/A]AGCCACAGAAACGGTGGATATGTTTCATATCCTCACCAAACAGGTCCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053804 Nonsense 1014 1183 24 27
ENSDART00000064236 Nonsense 652 821 18 21
ENSDART00000121475 Nonsense 1012 1181 26 29
ENSDART00000122920 Nonsense 652 821 17 20
ENSDART00000126384 Nonsense 1193 1362 26 29
Genomic Location:
Chromosome 23 (position 29755258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTGCCATGTTGAATTATAACCTGCAGCAGCTATGTGGGCCTAAATG[T/A]CGAGACTTGAAGGTGGAAAACCCTGAAAAATATGGTTTCGAGCCAAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hepatocellular carcinoma: Genome-wide association study identifies 1p36.22 as a new susceptibility locus for hepatocellular carcinoma in chronic hepatitis B virus carriers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ph3k6w8f