bscl2

Ensembl ID:
ENSDARG00000037008
ZFIN ID:
ZDB-GENE-051113-140
Description:
seipin [Source:RefSeq peptide;Acc:NP_001032473]
Human Orthologue:
BSCL2
Human Description:
Berardinelli-Seip congenital lipodystrophy 2 (seipin) [Source:HGNC Symbol;Acc:15832]
Mouse Orthologue:
Bscl2
Mouse Description:
Bernardinelli-Seip congenital lipodystrophy 2 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:129839

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37326 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053791   346 350 10 10
ENSDART00000125249 Essential Splice Site 382 441 None 10
Genomic Location (Zv9):
Chromosome 21 (position 26077085)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26646903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGTGATTGGGACGGAAGACCTGAATAACCAACAAGAGGATGAAACTGG[T/C]AAAAATATTACATAAAACGTAAATCTCATCACAAATGTAATTTTTAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link