tbc1d16

Ensembl ID:
ENSDARG00000036994
ZFIN ID:
ZDB-GENE-041010-179
Description:
Zgc:101681 [Source:UniProtKB/TrEMBL;Acc:Q5XJQ4]
Human Orthologue:
TBC1D16
Human Description:
TBC1 domain family, member 16 [Source:HGNC Symbol;Acc:28356]
Mouse Orthologue:
Tbc1d16
Mouse Description:
TBC1 domain family, member 16 Gene [Source:MGI Symbol;Acc:MGI:2652878]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053771 Nonsense 5 327 2 5
ENSDART00000104277 Nonsense 5 717 1 11
ENSDART00000135470 Nonsense 5 327 2 5
ENSDART00000136243 Nonsense 5 717 2 12

The following transcripts of ENSDARG00000036994 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 18176556)
KASP Assay ID:
554-0224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAAAGGATGGGAGCAGTGAGCGGTCACTGGAGGAGATGTCATTCGGT[C/T]GACTCCTGCGACGTGCATCCTCCAAAGCCTCTGACTTTTTGACGTTTAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mc3ywe9z