erbb3b

Ensembl ID:
ENSDARG00000036993
ZFIN ID:
ZDB-GENE-050107-1
Description:
hypothetical protein LOC100149258 [Source:RefSeq peptide;Acc:NP_001122291]
Human Orthologue:
ERBB3
Human Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) [Source:HGNC Symbol;Acc:3431]
Mouse Orthologue:
Erbb3
Mouse Description:
v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) Gene [Source:MGI Symbol;Acc:MGI:95

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14974 Nonsense Available for shipment Available now
sa5978 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8650 Nonsense Mutation detected in F1 DNA During 2014
sa18520 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 85 1430 3 28
ENSDART00000128510 Nonsense 85 1429 3 29
ENSDART00000138974 Nonsense 85 1426 3 28
Genomic Location:
Chromosome 23 (position 25538587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATRACATGCTTGACNTTTCTTCTAGAGTATCCGAGAGGTCACCGGCTA[C/A]ATCCTCWTTGCGATGAACCAGTTTCGCAAGTTACCTTTGAATCAGCTCMG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Essential Splice Site 538 1430 13 28
ENSDART00000128510 Essential Splice Site 537 1429 14 29
ENSDART00000138974 Essential Splice Site 534 1426 13 28
Genomic Location:
Chromosome 23 (position 25558088)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTACAGTCGGCTCGGCACCTGTGTGTCTCACTGTAACCTCTACTMCGG[G/T]TCAGTGTTAGTTAGTTATTTTTTTATAGTTATTAAATGTTGGGTCGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
Genomic Location:
Chromosome 23 (position 25565609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGTATTATCTGGAGGAGCACTGCATGGCCCATAGGAACCTGGCTGCA[C/T]GAAACATACTGCTCAAGAGTGACTACATAGTACAGATCTCGGACTTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18520
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
ENSDART00000049893 Nonsense 840 1430 21 28
ENSDART00000128510 Nonsense 839 1429 22 29
ENSDART00000138974 Nonsense 836 1426 21 28
Genomic Location:
Chromosome 23 (position 25565609)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGTATTATCTGGAGGAGCACTGCATGGCCCATAGGAACCTGGCTGCA[C/T]GAAACATACTGCTCAAGAGTGACTACATAGTACAGATCTCGGACTTTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/54ico63q