has2

Ensembl ID:
ENSDARG00000036987
ZFIN ID:
ZDB-GENE-020828-1
Description:
hyaluronan synthase 2 [Source:RefSeq peptide;Acc:NP_705936]
Human Orthologue:
HAS2
Human Description:
hyaluronan synthase 2 [Source:HGNC Symbol;Acc:4819]
Mouse Orthologue:
Has2
Mouse Description:
hyaluronan synthase 2 Gene [Source:MGI Symbol;Acc:MGI:107821]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22788 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11334 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22788
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018931 None 1 552 None 3
ENSDART00000053754 Essential Splice Site 1 552 None 4
Genomic Location:
Chromosome 16 (position 17757039)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAACAGTAAATCATAATAGTCACCCTTTTGCATTTTATTGCTTGTTTC[A/G]GATGAGATGTGATAAAGCGGTCAGCTACTTAAGGATTGTTGGGACGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11334
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018931 Nonsense 362 552 3 3
ENSDART00000053754 Nonsense 362 552 4 4
Genomic Location:
Chromosome 16 (position 17752950)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCTGGCTCAACCAACAAACCCGCTGGAGTAAATCCTATTTCAGAGAGT[G/A]GCTTTACAACTCCTTGTGGTTCCACAAGCACCACTTGTGGATGACYTACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kxu3c0mj