hsd3b7

Ensembl ID:
ENSDARG00000036966
ZFIN ID:
ZDB-GENE-030131-5673
Description:
3 beta-hydroxysteroid dehydrogenase type 7 [Source:RefSeq peptide;Acc:NP_956103]
Human Orthologue:
HSD3B7
Human Description:
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Hsd3b7
Mouse Description:
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33221 Essential Splice Site, Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33221
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053684 Essential Splice Site 55 368 None 6
ENSDART00000121983 Essential Splice Site 55 368 None 7
ENSDART00000125260 Splice Site None 366 None 7

The following transcripts of ENSDARG00000036966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 32900348)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32631658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAGATAGGATTTCTTAAATTGCTAAGCACGTTTTTTCTTTTATTCAC[A/T]GAGGATGTGAAAGTGGTCATCATACAGGGAGATATAACAAAATATGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link