rnf24

Ensembl ID:
ENSDARG00000036965
ZFIN ID:
ZDB-GENE-041114-40
Description:
RING finger protein 24 [Source:RefSeq peptide;Acc:NP_001007353]
Human Orthologue:
RNF24
Human Description:
ring finger protein 24 [Source:HGNC Symbol;Acc:13779]
Mouse Orthologue:
Rnf24
Mouse Description:
ring finger protein 24 Gene [Source:MGI Symbol;Acc:MGI:1261771]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17925 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053681 Nonsense 129 149 6 6
ENSDART00000144098 None None 51 None 4

The following transcripts of ENSDARG00000036965 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 42154240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGGTTTGCCCGCTGTGCAACATGCCAGTCTTACAGCTGGCGCAGCAG[C/T]AGAGCAWGTCTGAACCCAWTGCCCCAACACAGCAACATCTGCCCGGGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tlbjvwnw