si:dkey-202m22.6

Ensembl ID:
ENSDARG00000036952
ZFIN IDs:
ZDB-GENE-091117-2, ZDB-GENE-091214-2
Description:
XK-related protein 7 [Source:RefSeq peptide;Acc:NP_001012252]
Human Orthologue:
XKR7
Human Description:
XK, Kell blood group complex subunit-related family, member 7 [Source:HGNC Symbol;Acc:23062]
Mouse Orthologue:
Xkr7
Mouse Description:
X Kell blood group precursor related family member 7 homolog Gene [Source:MGI Symbol;Acc:MGI:3526711

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37748 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37749 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053661 Essential Splice Site 240 560 2 3
Genomic Location (Zv9):
Chromosome 23 (position 31117095)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30951985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGCTCAGCATTATGGTCCAGACCGGCCAGATTCTCCCTTTACAGGG[T/C]AAGTGTTGACAGCTATGATTAAAACCCACTCTCTACAAGTATGCTAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37749
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053661 Nonsense 349 560 3 3
Genomic Location (Zv9):
Chromosome 23 (position 31128569)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30963459
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGATCATCTACAACATGATGGTGGGCATTGTGTATATATTCTGCTG[G/A]TTCAGCGTTCGTGAGGGTCCCACGCGGGGCCGTCTTCTGCTGTACAGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link