gpd1

Ensembl ID:
ENSDARG00000036942
ZFIN ID:
ZDB-GENE-040426-2576
Description:
glycerol-3-phosphate dehydrogenase 1 (soluble) [Source:RefSeq peptide;Acc:NP_999918]
Human Orthologue:
GPD1L
Human Description:
glycerol-3-phosphate dehydrogenase 1-like [Source:HGNC Symbol;Acc:28956]
Mouse Orthologue:
Gpd1l
Mouse Description:
glycerol-3-phosphate dehydrogenase 1-like Gene [Source:MGI Symbol;Acc:MGI:1289257]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23400 Nonsense Available for shipment Available now
sa36742 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23400
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053639 Nonsense 33 349 2 10
ENSDART00000134266 Nonsense 33 349 2 8

The following transcripts of ENSDARG00000036942 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 334293)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 324224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCATCGCTAAGATCGTGGGCCACAATGTGAAGTCTTCCAACCGCTTC[G/T]AGCCGCTGGTGAAGATGTGGGTCTACGAGGAGATGATCGACGGACGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36742
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053639 Essential Splice Site 121 349 None 10
ENSDART00000134266 Essential Splice Site 121 349 None 8

The following transcripts of ENSDARG00000036942 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 329980)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 319911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCGTGTTACCCACACACAAAGCACATATACACATGTTTGTGTGTGTTC[A/T]GGGTATTGACGAGGGTCCGGACGGCCTGACTCTGATCTCTGACATCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link