tbx18

Ensembl ID:
ENSDARG00000036930
ZFIN ID:
ZDB-GENE-020529-2
Description:
T-box transcription factor TBX18 [Source:RefSeq peptide;Acc:NP_705951]
Human Orthologue:
TBX18
Human Description:
T-box 18 [Source:HGNC Symbol;Acc:11595]
Mouse Orthologue:
Tbx18
Mouse Description:
T-box18 Gene [Source:MGI Symbol;Acc:MGI:1923615]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24370 Nonsense Mutation detected in F1 DNA During 2015
sa29963 Essential Splice Site Mutation detected in F1 DNA During 2015
sa24371 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa24370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103448 Nonsense 120 554 2 8
ENSDART00000126206 Nonsense 120 563 2 10
Genomic Location:
Chromosome 23 (position 31347872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGCTCCGGGGAGGAGATGCGCGTGGACCTGCAGGGCTCAGACTTGTGG[A/T]AGCGATTTCACGAGATTGGAACTGAAATGATCATCACCAAAGCCGGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29963
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103448 Essential Splice Site 136 554 3 8
ENSDART00000126206 Essential Splice Site 136 563 3 10
Genomic Location:
Chromosome 23 (position 31348453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAACTTAAGTATGATGAAAATATTAATATTACATTTGTATTATATCCC[A/T]GGCGAATGTTTCCCGCGATGAGGGTTAAGATTGCGGGACTGGACCCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103448 Nonsense 303 554 6 8
ENSDART00000126206 Nonsense 304 563 6 10
Genomic Location:
Chromosome 23 (position 31351345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGAAGATCGACAGGAATCCATTTGCAAAGGGATTTAGAGACTCGGGA[C/T]GAAACAGGTAAATGTAGAAAATTATACAAGCTAAAGTAATGGCTGGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6vx20mpk