tbx18

Ensembl ID:
ENSDARG00000036930
ZFIN ID:
ZDB-GENE-020529-2
Description:
T-box transcription factor TBX18 [Source:RefSeq peptide;Acc:NP_705951]
Human Orthologue:
TBX18
Human Description:
T-box 18 [Source:HGNC Symbol;Acc:11595]
Mouse Orthologue:
Tbx18
Mouse Description:
T-box18 Gene [Source:MGI Symbol;Acc:MGI:1923615]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24370 Nonsense Mutation detected in F1 DNA During 2014
sa24371 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103448 Nonsense 120 554 2 8
ENSDART00000126206 Nonsense 120 563 2 10
Genomic Location:
Chromosome 23 (position 31347872)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAGCTCCGGGGAGGAGATGCGCGTGGACCTGCAGGGCTCAGACTTGTGG[A/T]AGCGATTTCACGAGATTGGAACTGAAATGATCATCACCAAAGCCGGCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103448 Nonsense 303 554 6 8
ENSDART00000126206 Nonsense 304 563 6 10
Genomic Location:
Chromosome 23 (position 31351345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGAAGATCGACAGGAATCCATTTGCAAAGGGATTTAGAGACTCGGGA[C/T]GAAACAGGTAAATGTAGAAAATTATACAAGCTAAAGTAATGGCTGGAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6vx20mpk