rnf139

Ensembl ID:
ENSDARG00000036929
ZFIN IDs:
ZDB-GENE-080401-4, ZDB-GENE-080401-4, ZDB-GENE-080401-4
Description:
RING finger protein 139 [Source:RefSeq peptide;Acc:NP_001116520]
Human Orthologue:
RNF139
Human Description:
ring finger protein 139 [Source:HGNC Symbol;Acc:17023]
Mouse Orthologue:
Rnf139
Mouse Description:
ring finger protein 139 Gene [Source:MGI Symbol;Acc:MGI:1923091]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23398 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23398
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000053622 Nonsense 32 664 1 3
ENSDART00000122054 Nonsense 32 664 1 2
ENSDART00000129713 Nonsense 32 664 1 4
Genomic Location:
Chromosome 19 (position 181919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGATGTGGTTCTGCGGGTCCCGAGCATCTTTATAATCGACGCCATAT[T/A]GAACTCGTACTCTGATCCCGGTACCGGATGGAGCGGCGCCGCCGGGAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bfzpgcan